Research Article

OCT4B1 Suppression down Regulated BCL2 Gene Family Expression in Human Tumor Cell Lines

Mirzaei MR*, Hassanshahi GH, Mahmoodi M, Hajizadeh MR, Asadi F, Pooladvand V

Mirzaei MR1,2*, Hassanshahi GH1,3, Mahmoodi M1,2, Hajizadeh MR1,2, Asadi F2, Pooladvand V4

1Molecular Medicine Research Center, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
2Departments of Biochemistry, School of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
3Departments of Immunology, School of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
4Departments of Biochemistry, School of Medicine, jiroft University of Medical Sciences, Jiroft, Iran

*Address for Correspondence: Mohammad Reza Mirzaei, Molecular Medicine Research Center, Rafsanjan University of Medical Sciences, Rafsanjan, Iran. Tel: 00983434315201; Mobile: 00989133912151; Fax: 009834280097; E-mail: mirzaeemr@gmail.com

Dates: Submitted: 30 May 2017; Approved: 11 June 2017; Published: 14 June 2017

Citation this article: Mirzaei MR, Hassanshahi GH, Mahmoodi M, Hajizadeh MR, Asadi F, et al. OCT4B1 Suppression down Regulated BCL2 Gene Family Expression in Human Tumor Cell Lines. Int J Cancer Cell Biol Res. 2017; 2(1): 023-028.

Copyright: © 2017 Mirzaei MR, et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Keywords: OCT4B1; BCL2 Gene Family; Tumor Cell Lines

Abstract

Background and Aims: The OCT4B1, an important OCT4 variant is expressed more than other variants in both human cancer cell lines and tissues. New finding showed this variant has anti-apoptotic potency in mentioned cells and tissues. BCL2 family is one of the twelve gene families involved in apoptosis pathway with negative control in apoptosis recurrence. The aim of the present study was to investigate the effects of OCT4B1 silencing on several genes of BCL2 family in human tumor cell lines.

Materials and Methods: three human tumor cell lines; AGS (gastric adenocarcinoma), 5637 (bladder tumor) and U-87MG (brain tumor) were transfected with specific OCT4B1 siRNA and a scrambled sequence as control, using Lipofectamine 2000 comerical kit. Following, The expression rate of BCL2 gene family transcripts were evaluated in parallel with beta-actin (as housekeeping gene) using Real-Time PCR technique.

Results: Expressional profile of the studied BCL2 transcripts in three cell lines is almost similar. Nineteen of twenty one studied genes in BCL2 family showed down-regulation, forteen gene were decreased in expression more than 3 and three genes (BAD,BCL2 and BNIP3L) more than 10 folds. BCLAF1 showed up-regulation (in U87MG and 5637 tumor cell lines) and MCL1 showed unchanged gene expression.

Conclusions: According to these results, it may be concluded that OCT4B1 suppression can lead to apoptosis in tumor cell lines via down-regulation of several BCL2 transcripts. Thus, OCT4B1 suppression effects on BCL2 may be considered as promising target genes in future studies in cancer research and therapy.

Introduction

OCT4 is an important and critical genes involved in both embryonic and adult stem cell proliferation and differentiation [1]. OCT4 belong to a family of transcription regulatory genes containing the PUO DNA binding domain, located on human chromosome 6 that potentially encodes at least three different variants (A, B and B1) via mRNA alternative splicing [2]. OCT4 is expressed in stem cells and induced cell survival (immortalization), while, silencing or down regulation of this gene caused cell differentiation [3-5]. According to the “cancer stem cell” theory of cancer, cancers are originated from either adult stem cells (tissue stem cells, presented in almost all tissues) or reprogrammed tissue somatic cells [6-8]. New finding revealed that there are similar pattern of gene expression in both cancer and normal stem cells [7, 9]. So, investigation of genes collaborated in both normal and cancer stem cells and especially finding the differences of gene's variants expression pattern in mentioned cells, were considered by cancer researchers. Because of OCT4 alternative splicing and producing of at least three different variants by specific function, were candidate genes and investigation showed that a new variant of OCT4, known as OCT4B1, is expressed in both normal stem cells (embryonic and adult) and cancer cell lines/ cancer tissues [10, 11]. While OCT4A variant expressed mainly in embryonic stem cells and silenced followed differentiation and OCT4B variant expressed in a wide variety of cells (stem and somatic cells) with no function in cell pluripotency [12]. New study revealed the OCT4B1 variant has anti-apoptotic potency in cancer cell lines [1, 9]. One hypothesis suggests that it can affect the expression of essential genes involved in cell survival and cell death, especially programmed cell death (apoptosis) to induce the self-renewal state of the cell.

Apoptosis is a specialized biochemical pathway for removal of the aggressive cells including cancer cells [13]; however, within the cancer tissues and cancer cell lines, apoptosis would be decreased or suppressed [14]. Delineation of both cellular and molecular mechanisms that contribute to these suppression processes could be considered as promising targets in cancer therapy.

There are at least eleven gene families related to apoptotic pathway, of which BCL2 gene family is most important of these families [15, 16, 17]. Most of the BCL2 family genes have been found to play a central regulatory role in apoptosis induction [18]. High level of BCL2 family proteins are considered primarily responsible for inhibiting apoptosis in lot of cancer types [19].

Mammalian BCL2 protein family consists of at least 30 related proteins, characterized by the presence of up to four relatively short sequence motifs (less than 20 amino acid residues in length) termed BCL2 homology (BH) domains [20]. BCL2 family is divided into three different subclasses based on structural and functional features: Prosurvival or Antiapoptotic Family Members, Proapoptotic Family Members and BH3-Only Family Members [21, 22, 23, 24]. Normal cellular homeostasis appears to be dependent on the balance between pro- and anti-apoptotic members of BCL2 family. BCL2 gene is over-expressed in almost all types and subtypes of leukemia, indicating the importance of this molecule in disease pathogenesis and evolution [18].

The aim of this study was to explore the expression profile of several BCL2 family genes in three human tumor cell lines including AGS (gastric adenocarcinoma), 5637 (bladder tumour) and U-87MG (brain tumour) followed OCT4B1 suppression.

Materials and Methods

Human tumor cell lines and cell culture

The human tumor cell lines; AGS (gastric adenocarcinoma), 5637 (bladder tumour) and U-87MG (brain tumour) were prepared from pasture cancer institute (IRAN) and cultured in RPMI-1640 (Gibco) medium containing 10% fetal bovine serum and antibiotics (100 mg/mL streptomycin and 100 U/mL penicillin) at 37°C in a humidified incubator containing 5% CO2.

RNA extraction, cDNA synthesis and Real-time PCR

Total RNA was extracted from cultured cells (106 cells/ml) using TRIzol reagent (Invitrogen, UK). The contaminated DNA in the RNA samples was removed by TURBO DNase I (Fermentase, Lithuania). The RNA fidelity purity and integrity were measured by spectrophotometer (260/280 NM ratio) and gel electrophoresis (1% agarose gel). The first strand cDNA was synthesized at 42ºC for 60 min using 100 pmol oligo-dT primer, 200 units of MMuLV reverse transcriptase and 1µg of total RNA according to the manufacturer’s instructions (Fermentase, Lithuania). Specific primers were designed for OCT4 variants (A, B and B1), interested BCL2 family genes transcripts and ß-actin, using Gene Runner (version 3.02) and Allele ID (version 4.0) software (Table 1). Quantitative real-time PCR was performed by addition of SYBR green master mix (Qiagene, USA), 200ng of the cDNA, and 2 pgr/µl of the appropriate primer pairs (Table 2). The following cycling program was set on the BIO-RAD CFX96 instrument (Bio-Rad Company, USA): one cycle at 95ºC for 15 minutes, 40 cycles at 95ºC for 30 seconds, 60ºC for 30 seconds (OCT4B1, 61ºC for 40 seconds), and 72ºC for 30 seconds. Real-time PCR was carried out in triplicate and ß-actin was used as a housekeeping internal control for normalization of amplified target genes. The proportional amounts of PCR products were determined using the 2-∆∆Ct formula. The dissociation stages, melting curves and quantitative analyses of the data were performed using CFX manager software version 1.1.308.111 (Bio-Rad, USA).

Table 1: BCL2 genes family up/down regulated after OCT4B1 suppression in 5637, AGS and U87MGtumor cell lines.
Symbols Description of genes Cell Lines/ Fold changes
    AGS 5637 U87M
BAD BCL2-associated agonist of cell death -15.35 -12.24 -17.56
BAG1 BCL2-associated athanogene -5.84 -4.26 -2.94
BAG3 BCL2-associated athanogene 3 -5.48 -3.41 -9.72
BAG4 BCL2-associated athanogene 4 -7.46 -6.93 -12.03
BAK1 BCL2-antagonist/killer 1 -13.69 -17.88 -9.93
BAX BCL2-associated X protein -19.77 -16.93 -8.00
BCL2 B-cell CLL/lymphoma 2 -17.83 -15.28 -17.04
BCL2A1 BCL2-related protein A1 -6.93 -4.48 -8.42
BCL2L1 BCL2-like 1 -3.45 -7.03 -4.28
BCL2L10 BCL2-like 10 (apoptosis facilitator) -6.89 -4.38 -5.03
BCL2L11 BCL2-like 11 (apoptosis facilitator) -12.83 -9.84 -11.20
BCL2L2 BCL2-like 2 -6.30 -2.49 -2.66
BCLAF1 BCL2-associated transcription factor 1 4.40 3.92 4.01
BID BH3 interacting domain death agonist -7.12 -5.90 -8.03
BIK BCL2-interacting killer (apoptosis-inducing) -3.82 -5.04 -3.71
BNIP1 BCL2/adenovirus E1B 19kDa interacting protein 1 -7.83 -9.50 -3.62
BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 -8.79 -13.71 -9.33
BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 -4.73 -3.67 -6.03
BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like -12.89 -14.74 -13.72
HRK Harakiri, BCL2 interacting protein -6.73 -7.30 -6.28
MCL1 Myeloid cell leukemia sequence 1 (BCL2-related) 3.80 2.38 3.71

All of the PCR products were electrophoresed and visualized using a 1% agarose gel containing 0.5 mg/ml ethidium bromide to visualize the size and uniqueness of amplified products.

OCT4B1 knock-down in tumor cell lines

To silencing the OCT4B1 variant, two specific siRNA were utilized based on the specific OCT4B1 sequences. One irrelevant or scrambled siRNA (with no complementary target sequence in the human genome) were transfected under the same conditions as controls. The siRNA were designed by a selection program (Whitehead Institute for Biomedical Research, htt://jura.wi.mit.edu/) and the process of synthesis was performed by MWG Company (Germany) (Table 2).

Table 2: sequences and criteria of designed siRNAs.
siRNA name Target Sequences
Version I Target AAGGAGTATCCCTGAACCTAG
Sense (GGAGUAUCCCUGAACCUAG)dTdT
Anti-sense (CUAGGUUCAGGGAUACUCC)dTdT
Version II Target AAGAGGTGGTAAGCTTGGATC
Sense (CAGUGGUAAGCUUGGAUC)dTdT
Anti-sense (AAUCCAAGCUUACCACCUC)dTdT
Scramble Sense GCGGAGAGGCUUAGGUGUAdTdT
Anti-sense UACACCUAAGCCUCUCCGCdTdT

For siRNA transfection, lipofection method was used; briefly, a suspension of freshly cultured cells was prepared (1×105 cells/ml/well) in the RPMI1640 culture media without antibiotics and seeded in six well plates in two groups (test and control). During logarithmic growth phase (confluences 30-50%), cells were transfected with 50 nmol/ml synthetic siRNA (in the control group, scrambled sequence siRNA), using lipofectamin 2000 (Invitrogen, USA) and Opti-MEM media, according to the manufacturers’ instructions. In brief, 5µl of siRNA (25µM) and 4.5 µl RNAi-MAX reagents were diluted in 250 µl Opti-MEM and incubated for 10 min at room temperature. The mixture was then added to the cells in a final volume of 2.5ml, and then the cells were incubated at 37ºC in a humid atmosphere of 5% CO2 for 72 hours.

MTT Assay

The cell viability was determined using 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay on the basis of the ability of viable cells to metabolize MTT. MTT is a water-soluble tetrazolium salt which can be metabolized into a water-insoluble formazan product by mitochondrial succinate dehydrogenase in viable cells [25]. Briefly, 7x104 cells/ml/well were seeded onto a 96-well plate at a final volume of 200 μL. Subsequent to cell transfection, the resultant supernatant was replaced by 200 μL of pre-warmed RPMI 1640 (without phenol red) and continued by addition of 10 μL of 5 mg/ml MTT to each well. The plate was incubated at 37˚C for 3.5 h in the dark until a purple precipitate was visible under light microscopy. Finally, 100 μL of DMSO (dimethyl sulphoxidase) was added to each well and 15 min after the absorbance (at 570 nm) was read after with a reference filter of 620 nm.

Apoptosis analysis

The ratio of apoptotic cell in OCT4B1 siRNA transfected cells (test group) against the scrambled sequence siRNA transfected cell (control group) was detected 48 hours after transfection. Single cell suspension was carried out, and the Annexin V- FLOUS kit (Roch, Germany) was used for detection of the exposed phosphatidylserin on cell surfaces, as described elsewhere [26]. Then, 48 hours after transfection, cells (1×106) were centrifuged and resuspended in 200µl of binding buffer. Annexin V-FLOUS (1µl) and propidium iodide (1µl) were added to tubes after 5 minutes and were further incubated for 5 minutes at room temperature (in the dark) and then analyzed by Beckman-Coulter Elite flow cytometer. Annexin V-FLOUS binding was detected using a FITC signal detector (FL1) and propidium iodide staining by the phycoerythrin emission signal detector (FL3). The ratio of FITC/PI positive cells (apoptosis) was calculated from flow histograms [27].

BCL2 gene transcripts profiling

Followed suppression of OCT4B1 variant, mRNA synthesis of twenty one transcripts in BCL2 genes family was detected. Total RNA from test and control group were extracted, cDNA synthesized and Quantitative Real Time PCR was performed as described. The following cycling program was set on a BIO-RAD CFX96 system (Bio-Rad Company, USA): one cycle at 95ºC for 15 min, 40 cycles at 95ºC for 30 S, 58-61ºC for 30 S and 72ºC for 30 S. Real-time PCR was carried out in triplicate and ß-actin was assessed as a housekeeping gene for the normalization of amplification signals of the target genes. The proportional amounts of PCR products were determined using the 2-∆∆Ct formula. Relative expression is determined by comparison of interested gene expression in test and control group using data from the real-time cycler and the ΔΔCT method. The dissociation stages, melting curves and quantitative analyses of the data were performed using CFX manager software version 1.1.308.111 (Bio-Rad, USA). All PCR products were visualized by electrophoresis on a 1% gel containing 0.5 mg/ml ethidium bromide to check the size of PCR products.

Results

Suppression of OCT4B1variant in AGS, 5637, and U87MG cell lines

After confirming the expression of OCT4B1 in three different cell lines (Figure 1), we employed two specific siRNAs to suppress OCT4-B1 expression in the aforementioned cell lines. Compared to the cells transfected with a scrambled siRNA, as the control group, the expression of OCT4B1 was sharply suppressed at 24, 48 and 72 hours following OCT4B1: siRNA transfection. As it is shown in (Figure 2) for AGS cells, the highest decline in OCT4B1 expression occurred at 48 hours post-transfection, using OCT4B1: siRNA version 1. For that reason, the next experiments were carried out by siRNA version 1 and for 48 hours post-transfection time, in triplicate. The same observations were made for the other tested cell lines (data not shown).While the morphology of the 5637, and U87MG cell lines was not distinguishable for cells transfected with OCT4B1 vs. scrambled siRNAs, a remarkable morphological change including the presence of multinucleate giant cells was observed in AGS cells transfected with OCT4B1:siRNA (data not shown).

Figure 1: Demonstrates OCT4B1 expression level after 24, 48 and 72 hours of siRNA transfection. Y axis shows OCT4B1 variance mRNA expression compared to ß-actin (housekeeping as control gene) and X axis indicates AGS tumor cell lines, Test; transfected cells with OCT4B1 siRNA and Control; transfected cells with scramble siRNA.

Figure 2: Demonstrates level of OCT4 variants expression in studied tumor cell lines. Y axis shows OCT4B1 variance mRNA expression level compared to ß-actin (as housekeeping control gens) and X axis indicates three studied tumor cell lines (AGS, 5637 and U87MG).

Elevated apoptosis and decreased viability of studied tumor cell lines treated with specific OCT4B1 siRNA

Flow cytometry analysis of the cells stained with Annexin V and PI demonstrated that two days after siRNA transfection up to 33% of the test group cells (transfected by specific OCT4B1 siRNA) underwent apoptosis, in comparision to control cells (transfected by scrambled sequence siRNA)(Figure 3).

Figure 3: Flow cytometric analysis of OCT4B1 suppressed in AGS tumor cell line. Test; transfected cells with OCT4B1 siRNA and Control; transfected cells with scramble siRNA. The cells falling in the lower right square in scatter diagram are considered as apoptotic cells. Apoptosis analyzed by using Annexin-V-FLOS assay kit, Annexin V-FLOUS binding was detected using a FITC signal detector (FL1) and propidium iodide staining by the phycoerythrin emission signal detector (FL3).

MTT assay also indicated reduced cell activity after OCT4B1 siRNA transfection compared to cells transfected by scrambled sequence siRNA and mock transfected control cells.(Figure not shown).

Quantitative Real-time PCR results

Our data revealed that all OCT4 three variants were expressed in the studied cell lines (Figure 1). Expressional profile of the studied BCL2 transcripts in three cell lines is almost similar (Table 2, Figures 4a and 4b). Nineteen of twenty one studied genes in BCL2 family showed down-regulation, from these, 14 gene were decreased in expression more than 3 and three genes (BAD,BCL2 and BNIP3L) more than 10 folds. BCLAF1 showed up-regulation (in U87MG and 5637 tumor cell lines) and MCL1 showed unchanged gene expression.

Figure 4a: Demonstrates BCL2 gene expression, 48 hours after siRNA transfection in studid tumor cell lines. Y axis showed fold gene regulation and X axis showed 11 genes of BCL2 gene family.

Figure 4b: Demonstrates BCL2 gene expression, 48 hours after siRNA transfection in studid tumor cell lines. Y axis showed folds gene regulation and X axis showed 10 genes of BCL2 gene family.

Discussion

Based on anti-apoptotic effect of OCT4B1[1, 28] and “cancer stem cell” hypothesis of cancer, we aimed to explore the gene expression alteration of 21 genes of BCL2 family after suppression of OCT4B1 variant in three tumor cell lines; AGS (gastric adenocarcinoma), 5637 (bladder tumour) and U-87MG (brain tumour).

The results demonstrated that OCT4B1 variant is highly expressed in all aforementioned cell lines. Interestingly, OCT4B1 suppression generated almost similar pattern of gene expression alterations of studied genes in all three cell lines, suggesting general targets of OCT4B1 within BCL2 family, one of the critical gene families that control apoptosis pathway.

In general, progression of tumor growth is characterized by a net increase in the number of tumor cells. This could be due to increased proliferation and/or decreased apoptosis, or both. A coordination and balance between cell proliferation and apoptosis is crucial for normal development [28]. Bcl-2 gene family is the best known genes for its ability to suppress apoptosis.

As expected, OCT4B1 silencing caused a significant decrease in cell survival and a significant elevation in apoptosis rate of the transfected cells. Quantitative real-time PCR method were used to detect gene expression alteration of cells transfected with OCT4B1 siRNA compared same cell lines transfected by irrelevant (scramble) siRNA and results showed more than 90% (19 out of 21) of studied genes were decreased in expression (down-regulation). The highest alteration take place in BCL2, BCL2L11, BAD, BAX and BNIP3L genes with down-regulation more than 10 folds (Table 2).

Acknowledgment

This project was supported by a grant from the Rafsanjan University of Medical Sciences.

References

  1. Asadi MH, Mowla SJ, Fathi F, Aleyasin A, Asadzadeh J, Atlasi Y. 'Oct4b1, a Novel Spliced Variant of Oct4, Is Highly Expressed in Gastric Cancer and Acts as an Antiapoptotic Factor', Int J Cancer. 2011; 128: 2645-52. https://goo.gl/QHTndg
  2. Atlasi Y, Mowla SJ, Ziaee SA, Bahrami AR. 'Oct-4, an Embryonic Stem Cell Marker, Is Highly Expressed in Bladder Cancer', Int J Cancer. 2007; 120: 1598-602. https://goo.gl/iHsdsk
  3. Cheng L, Sung MT, Cossu-Rocca P, Jones TD, MacLennan GT, De Jong J. 'Oct4: Biological Functions and Clinical Applications as a Marker of Germ Cell Neoplasia', J Pathol. 2007; 211: 1-9. https://goo.gl/5iiKQC
  4. Livigni A, Brickman JM. 'Oct4: The Final Frontier, Differentiation Defining Pluripotency', Dev Cell. 2013; 25: 547-8. https://goo.gl/X0C18x
  5. G. Shi, and Y. Jin. 'Role of Oct4 in Maintaining and Regaining Stem Cell Pluripotency', Stem Cell Res Ther. 2010; 1: 39. https://goo.gl/K73Zcn
  6. C. J. Eaves, 'Cancer Stem Cells: Here, There, Everywhere?', Nature. 2008; 456: 581-2. https://goo.gl/pQV1T3
  7. Lobo NA, Shimono Y, Qian D, Clarke MF. 'The Biology of Cancer Stem Cells', Annu Rev Cell Dev Biol. 2007; 23: 675-99. https://goo.gl/B7zcSl
  8. Passegué E, Rafii S, Herlyn M.'Cancer Stem Cells Are Everywhere', Nat Med. 2009; 15: 23. https://goo.gl/By0abV
  9. Mirzaei MR, Najafi A, Arababadi MK, Asadi MH, Mowla SJ. 'Altered Expression of Apoptotic Genes in Response to Oct4b1 Suppression in Human'. Tumour Biol. 2014; 35: 9999-10009. https://goo.gl/w9a8RE
  10. Atlasi Y, Mowla SJ, Ziaee SA, Gokhale PJ, Andrews PW. 'Oct4 Spliced Variants Are Differentially Expressed in Human Pluripotent and Nonpluripotent Cells', Stem Cells. 2008; 26: 3068-74. https://goo.gl/q22sGl
  11. Mirzaei MR, Kazemi Arababadi M, Asadi MH, and Mowla SJ. 'Altered Expression of High Molecular Weight Heat Shock Proteins after Oct4b1'. Cell J. 2016; 17: 608-16. https://goo.gl/hhqrhu
  12. Papamichos SI, Kotoula V, Tarlatzis BC, Agorastos T, Papazisis K, Lambropoulos AF. 'Oct4b1 Isoform: The Novel Oct4 Alternative Spliced Variant as a Putative Marker of Stemness', Mol Hum Reprod. 2009; 15: 269-70. https://goo.gl/z6X8wF
  13. Elmore S. 'Apoptosis: A Review of Programmed Cell Death', Toxicol Pathol. 2007; 35: 495-516. https://goo.gl/y5KDYJ
  14. Taylor RC, Cullen SP, Martin SJ. 'Apoptosis: Controlled Demolition at the Cellular Level'. Nat Rev Mol Cell Biol. 2008; 9: 231-41. https://goo.gl/aHm7gg
  15. Gross A, McDonnell JM, Korsmeyer SJ. 'Bcl-2 Family Members and the Mitochondria in Apoptosis', Genes Dev. 1999; 13: 1899-911. https://goo.gl/90zKmK
  16. Marsden VS, Ekert PG, Van Delft M, Vaux DL, Adams JM, Strasser A. 'Bcl-2-Regulated Apoptosis and Cytochrome C Release Can Occur Independently of Both Caspase-2 and Caspase-9'.  J Cell Biol. 2004; 165: 775-80. https://goo.gl/G3eU8D
  17. S. Willis, C. L. Day, M. G. Hinds, and D. C. Huang. 'The Bcl-2-Regulated Apoptotic Pathway', J Cell Sci. 2003; 116: 4053-6. https://goo.gl/yZErJ9
  18. Thomadaki H, Scorilas A. 'Bcl2 Family of Apoptosis-Related Genes: Functions and Clinical Implications in Cancer', Crit Rev Clin Lab Sci. 2006; 42: 1-67. https://goo.gl/SWCirY
  19. Balakrishnan K, Gandhi V. 'Bcl-2 Antagonists: A Proof of Concept for Cll Therapy'. Invest New Drugs. 2013; 31: 1384-94. https://goo.gl/EMd9Zn
  20. Tzifi F, Economopoulou C, Gourgiotis D, Ardavanis A, Papageorgiou S, Scorilas A. 'The Role of Bcl2 Family of Apoptosis Regulator Proteins in Acute and Chronic Leukemias', Adv Hematol. 2012; 2012: 524308. https://goo.gl/6RII3u
  21. L. Khemtemourian, M. A. Sani, K. Bathany, G. Grobner, and E. J. Dufourc. 'Synthesis and Secondary Structure in Membranes of the Bcl-2 Anti-Apoptotic Domain Bh4'.  J Pept Sci. 2006; 12: 58-64. https://goo.gl/XcIzuA
  22. Petros AM, Olejniczak ET, Fesik SW. 'Structural Biology of the Bcl-2 Family of Proteins', Biochim Biophys Acta. 2004; 1644:  83-94. https://goo.gl/aeuED8
  23. Reed JC. 'Proapoptotic Multidomain Bcl-2/Bax-Family Proteins: Mechanisms, Physiological Roles, and Therapeutic Opportunities', Cell Death Differ. 2006; 13: 1378-86. https://goo.gl/yjzx0i
  24. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ. 'Serine Phosphorylation of Death Agonist Bad in Response to Survival Factor Results in Binding to 14-3-3 Not Bcl-X(L)'. Cell. 1996; 87: 619-28. https://goo.gl/fHkoBg
  25. Bernas T, Dobrucki J.'Mitochondrial and Nonmitochondrial Reduction of Mtt: Interaction of Mtt with Tmre, Jc-1, and Nao Mitochondrial Fluorescent Probes'. Cytometry.  2002; 47: 236-42. https://goo.gl/UZXDMn
  26. A. P. Demchenko. 'The Change of Cellular Membranes on Apoptosis: Fluorescence Detection'. Exp Oncol. 2012; 34: 263-8.
  27. Koopman G, Reutelingsperger CP, Kuijten GA, Keehnen RM, Pals ST, van Oers MH. 'Annexin V for Flow Cytometric Detection of Phosphatidylserine Expression on B Cells Undergoing Apoptosis'. Blood. 1994; 84: 1415-20. https://goo.gl/zxezUM
  28. Guo N, Peng Z.'Mg132, a Proteasome Inhibitor, Induces Apoptosis in Tumor Cells'.  Asia Pac J Clin Oncol. 2012; 9: 6-11. https://goo.gl/ZZmASe
Submit ManuscriptSubmit Special Issue

Authors submit all Proposals and manuscripts via Electronic Form!

All Journals

Creative Commons License Open Access by SciRes Literature is licensed under a Creative Commons Attribution 4.0 International License. Based on a work at www.scireslit.com.